Cofolga2mo website

(2011-05-31 updated)

Cofolga2mo is a structural RNA sequence alignment program based on multi-objective genetic algorithm. Non profit, academic users can download and use Cofolga2mo. For commercial use, please contact the author. These softwares are distributed as "no warranty" software. Copyright(C) 2009, Akito Taneda Lab..

Akito Taneda, Multi-objective pairwise RNA sequence alignment, Bioinformatics 26, 2383-2390 (2010) .

Akito Taneda, A Web Server for Multi-objective Pairwise RNA Sequence Alignment with an Index for Selecting Accurate Alignments, IPSJ Transactions on Bioinformatics 4, 2-8 (2011).

Akito Taneda, A Multi-Objective Genetic Algorithm for Pairwise RNA Sequence Alignment, The 20th International Conference on Genome Informatics, Posters and Software Demonstrations, P023, 2009.

The previous versions of Cofolga:

Akito Taneda , An efficient genetic algorithm for structural RNA pairwise alignment and its application to non-coding RNA discovery in yeast,. BMC Bioinformatics, 2008, 9:521.

Akito Taneda , Cofolga: a genetic algorithm for finding the common folding of two RNAs, Comput. Biol. Chem., 29, 111-119 (2005). pubmed, preprint

1. Vienna RNA package (for RNAfold)
2. Perl

We tested using "perl ver. 5.10.0 and Vienna RNA package ver. 1.8.3 on a Linux (Fedora 11, Intel Core2quad x86-64)" and "perl 5.8.8 and Vienna RNA package ver. 1.8.3 on a Linux (CentOS 5.3, Intel Core2duo x86-64) .

1. download cofolga2mo and cofolga2mo.pl (cofolga2ns & cofolga2ns.pl can also be downloaded).

We tested these files on Fedora Core release 11 (CPU: , Intel Core2quad). We believe that users can run Cofolga2mo on other RedHat-based Linux platforms.

2. copy the executable file (cofolga2mo or cofolga2mo.exe) and cofolga2mo.pl to the command search path, e.g. /usr/bin/.

Currently, I would like to distribute executable files alone.

2011-05-31 : cofolga2mo.tar.gz is updated. Linear weight index (its reference is here) is implemented in cofolga2mo0.2.pl, which is included in cofolga2mo.tar.gz.

To obtain Pareto optimal alignments :

cofolga2mo.pl [fasta file containing two RNA sequences]

This command will give you a number of Pareto optimal alignments denote by "Rk = 1". Alignments with a Rk = 2, 3, 4, ... and so on are not-Pareto, dominated solutions. An example of outputted alignment is shown below:

Individual= 24 Rk= 1 Sc= 69.899963 12.417937

> 1
GGCGGCAUGGCCAAGCGGU-AAGGCAGGGGACUGCAAAUCCUUUAUCCCCAGUUCAAAUCUGGGUGCCGCCU
> 2
GCCUUGAAAGCUCAACAACUAGAGCUUUGGUCUUGUAAACCAGGAGAGAGGGUAAACU-CCCUCUCAAGGCU

This example has a sequence similarity score s = 69.9 and secondary structure score P = 12.42.

The dataset includes 289 sequence pairs and reference structures (its2.tar.gz).
If you use the ITS2 dataset, please cite the ITS2 database paper:

Selig, C., Wolf, M., Muller, T., Dandekar, T. and Schultz, J. (2008):
The ITS2 Database II: homology modelling RNA structure for molecular systematics
Nucleic Acids Research 36:D377-380