|
1. To design the RNA sequence with a user-given
target structure, please type:
modena -f target.in
As a default, RNAfold is used as a direct problem
solver. This command will output a number of successfully designed
RNA sequences denote by "Individual .... 1.0". They are weak Pareto
optimal solutions and have a "Rk = 1". The other RNA sequences with
a Rk = 2, 3, 4, ... and so on are dominated solutions i.e. they are
designed unsuccessfully. It is noted that even the solutions with a
Rk = 1 can have a similarity score < 1.0 (this represents an
unsuccessful design). An example of the outputted RNAsequence is
shown below:
Individual= 17 Rk= 1 Sc=
7.900000 1.000000
AAAAACACCAGGACAUACCUGGAGAUAG
.......(((((.....)))))......
This example has a
structure stability score score epsilon = 7.9 and structure
similarity score sigma = 1.0. This is an example of a
successful design.
Individual= 9 Rk= 2 Sc=
5.500000 0.928571
CGGAAAAGUGAUCACGGAUCACCGAAAG
.......((((((...))))))......
This
example has a structure stability score score epsilon = 5.5
and structure similarity score sigma = 0.93. This is an
example of an UNSUCCESSFUL design since similarity score is 0.93,
which is not equal to 1.0.
2. To design RNA sequences with CentroidFold (as
a direct problem solver), please type:
modena -centf -f
target.in
To design pseudoknotted RNA sequences with IPknot (as
a direct problem solver), please type:
modena -ipknot -f
pseudoknot.in
3. The GA population size can be changed by a "-pop " option, and
the maximum GA iteration number can be changed with a "-it" option:
modena -f target.in -pop 100 -it 100
We recommend to set a same number to the population size and
iteration number.
To change the initial random number of MODENA, please use a -r
option (default: -r 12345)
modena -f target.in -r
12345
To change the crossover parameter n_c, please use a -cross option
(default: -cross 1),
where from '-cross 1' to '-cross 5' is available.
modena -f target.in -cross
2
4. For pseudoknot specification in the target structure file,, we can use ( ), < >, [ ] , { } , A a, B b, C c, D d, and E e to denote a base pair. For example, please see pseudoknot.in file in the modena????.tar.gz. |